Review



gene fusion construct memerald n wasp c 18  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc gene fusion construct memerald n wasp c 18
    Gene Fusion Construct Memerald N Wasp C 18, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+fusion+construct+memerald+n+wasp+c+18/mEmerald-N-Wasp-C-18+(Plasmid+%2354199)/pm33545089-542-6-32
    Average 91 stars, based on 4 article reviews
    gene fusion construct memerald n wasp c 18 - by Bioz Stars, 2026-10
    91/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Latent developmental potential to form limb-like skeletal structures in zebrafish.
    Article Snippet: .. Cell localization constructs and assay The gene fusion construct mEmerald-N-Wasp-C-18, consisting of an N-terminal GFP fused to theMusmusculus Wasl coding region driven by the CMV promoter, was a gift from Michael Davidson (Addgene plasmid #54199). .. Site-directed mutagenesis via the QuikChange II XL kit (Agilent) was used to introduce the S249P mutation with the primers Wasl_S249P_A and Wasl_S249P_B (sequence listed in Table S2).

    Article Title: Latent developmental potential to form limb-like skeletal structures in zebrafish
    Article Snippet: .. The gene fusion construct mEmerald-N-Wasp-C-18, consisting of an N-terminal GFP fused to the Mus musculus Wasl coding region driven by the CMV promoter, was a gift from Michael Davidson (Addgene plasmid #54199). .. Site-directed mutagenesis via the QuikChange II XL kit (Agilent) was used to introduce the S249P mutation with the primers 5’CCCAGCTTAAAGACAGAGAAACCTCAAAAGTTATTTATGACTTTATTG’3 and 5’CAATAAAGTCATAAATAACTTTTGGTGTTTCTCTGTCTTTAAGCTGGG’3.

    Plasmid Preparation:

    Article Title: Latent developmental potential to form limb-like skeletal structures in zebrafish.
    Article Snippet: .. Cell localization constructs and assay The gene fusion construct mEmerald-N-Wasp-C-18, consisting of an N-terminal GFP fused to theMusmusculus Wasl coding region driven by the CMV promoter, was a gift from Michael Davidson (Addgene plasmid #54199). .. Site-directed mutagenesis via the QuikChange II XL kit (Agilent) was used to introduce the S249P mutation with the primers Wasl_S249P_A and Wasl_S249P_B (sequence listed in Table S2).

    Article Title: Latent developmental potential to form limb-like skeletal structures in zebrafish
    Article Snippet: .. The gene fusion construct mEmerald-N-Wasp-C-18, consisting of an N-terminal GFP fused to the Mus musculus Wasl coding region driven by the CMV promoter, was a gift from Michael Davidson (Addgene plasmid #54199). .. Site-directed mutagenesis via the QuikChange II XL kit (Agilent) was used to introduce the S249P mutation with the primers 5’CCCAGCTTAAAGACAGAGAAACCTCAAAAGTTATTTATGACTTTATTG’3 and 5’CAATAAAGTCATAAATAACTTTTGGTGTTTCTCTGTCTTTAAGCTGGG’3.



    Similar Products

    gene fusion construct memerald n wasp c 18  (Addgene inc)
    91
    Addgene inc gene fusion construct memerald n wasp c 18
    Gene Fusion Construct Memerald N Wasp C 18, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+fusion+construct+memerald+n+wasp+c+18/mEmerald-N-Wasp-C-18+(Plasmid+%2354199)/pm33545089-542-6-32
    Average 91 stars, based on 1 article reviews
    gene fusion construct memerald n wasp c 18 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier

    Image Search Results